Job information

Job ID:2010y-11m-5d-8h-46m-43s-721r
Name:SigA
Organism:Bacteria-Mycobacterium_tuberculosis_H37Rv_uid57777
Specificity check program:blastn
Status:DONE
Submission date:Fri Nov 05 20:46:43 EDT 2010
Started date:Fri Nov 05 20:46:43 EDT 2010
Stopped date:Fri Nov 05 20:48:36 EDT 2010
Desired hybridization TM range:60.0-63.0
Desired amplicon size range:100-150bps
Number of primer pairs: -1
Target length: 200bps
Total mismatches to unintended targets:4
3' mismatches to unintended targets:2
Misprimed amplification distance threshold:3000
Execution problem?None

For the completion of this job, 3990 primer pairs were generated, and 379 oligos were blasted. The best primer pair for each target region are given hereafter.

Primers

PCRTiler managed to design 7 primer pairs out of the 7 requested target regions.

Amplicon
number
Primer
(5'->3')
TmAmplicon
length
Match
count
Amplicon
Count
Details
1
ccgatgagccggtaaaac
59.1110bps98 17
gggtggggagccactagc
63.0 205
2
caccatcccgaaaaggaa
59.4113bps210 512
cttcgtgctgggcatcct
62.4 1562
3
ggcgacgacgaagaccac
62.9100bps1 1
ccttttcggtgggttcag
59.1 1
4
cgtcaagcacgcaaggac
61.6127bps1 1
cctcgatccgcttggcta
62.4 1
5
cgcgaaaaaccatctgct
59.9107bps789 258
ggttgccttcctggatca
59.6 550
6
cgctacgtggtggattcg
61.3124bps1 1
cagcagctcgcgttgaat
61.3 1
7
ccgatctcgttggaccag
60.2115bps1 1
cctgcagcaaagtgaagg
58.1 1
What's this?

Sequences

>No name
gtggcagcgaccaaagcaagcacggcgaccgatgagccggtaaaacgcaccgccaccaagtcgcccgcggcttccgcgtc
cggggccaagaccggcgccaagcgaacagcggcgaagtccgctagtggctccccacccgcgaagcgggctaccaagcccg
cggcccggtccgtcaagcccgcctcggcaccccaggacactacgaccagcaccatcccgaaaaggaagacccgcgccgcg
gccaaatccgccgccgcgaaggcaccgtcggcccgcggccacgcgaccaagccacgggcgcccaaggatgcccagcacga
ag
ccgcaacggatcccgaggacgccctggactccgtcgaggagctcgacgctgaaccagacctcgacgtcgagcccggcg
aggacctcgaccttgacgccgccgacctcaacctcgatgacctcgaggacgacgtggcgccggacgccgacgacgacctc
gactcgggcgacgacgaagaccacgaagacctcgaagctgaggcggccgtcgcgcccggccagaccgccgatgacgacga
ggagatcgctgaacccaccgaaaaggacaaggcctccggtgatttcgtctgggatgaagacgagtcggaggccctgcgtc
aagcacgcaaggac
gccgaactcaccgcatccgccgactcggttcgcgcctacctcaaacagatcggcaaggtagcgctg
ctcaacgccgaggaagaggtcgagctagccaagcggatcgaggctggcctgtacgccacgcagctgatgaccgagcttag
cgagcgcggcgaaaagctgcctgccgcccagcgccgcgacatgatgtggatctgccgcgacggcgatcgcgcgaaaaacc
atctgct
ggaagccaacctgcgcctggtggtttcgctagccaagcgctacaccggccggggcatggcgtttctcgacctg
atccaggaaggcaacc
tggggctgatccgcgcggtggagaagttcgactacaccaaggggtacaagttctccacctacgc
tacgtggtggattcg
ccaggccatcacccgcgccatggccgaccaggcccgcaccatccgcatcccggtgcacatggtcg
aggtgatcaacaagctgggccgcattcaacgcgagctgctgcaggacctgggccgcgagcccacgcccgaggagctggcc
aaagagatggacatcaccccggagaaggtgctggaaatccagcaatacgcccgcgagccgatctcgttggaccagaccat
cggcgacgagggcgacagccagcttggcgatttcatcgaagacagcgaggcggtggtggccgtcgacgcggtgtccttca
ctttgctgcagg
atcaactgcagtcggtgctggacacgctctccgagcgtgaggcgggcgtggtgcggctacgcttcggc
cttaccgacggccagccgcgcacccttgacgagatcggccaggtctacggcgtgacccgggaacgcatccgccagatcga
atccaagactatgtcgaagttgcgccatccgagccgctcacaggtcctgcgcgactacctggactga

Annotated sequence

This sequence is suitable for copy/pasting in a program such as Genamics Expression.

<SEQUENCE_No_name>gtggcagcgaccaaagcaagcacggcga<AMPLICON_1><OLIGO_1_FW>ccgatgagccggtaaaac</OLIGO_1_FW>gcaccgccaccaagtcgcccgcggcttccgcgtc
cggggccaagaccggcgccaagcgaacagcggcgaagtcc<OLIGO_1_RV>gctagtggctccccaccc</OLIGO_1_RV></AMPLICON_1>gcgaagcgggctaccaagcccg
cggcccggtccgtcaagcccgcctcggcaccccaggacactacgaccag<AMPLICON_2><OLIGO_2_FW>caccatcccgaaaaggaa</OLIGO_2_FW>gacccgcgccgcg
gccaaatccgccgccgcgaaggcaccgtcggcccgcggccacgcgaccaagccacgggcgccca<OLIGO_2_RV>aggatgcccagcacga
ag</OLIGO_2_RV></AMPLICON_2>ccgcaacggatcccgaggacgccctggactccgtcgaggagctcgacgctgaaccagacctcgacgtcgagcccggcg
aggacctcgaccttgacgccgccgacctcaacctcgatgacctcgaggacgacgtggcgccggacgccgacgacgacctc
gactcg<AMPLICON_3><OLIGO_3_FW>ggcgacgacgaagaccac</OLIGO_3_FW>gaagacctcgaagctgaggcggccgtcgcgcccggccagaccgccgatgacgacga
ggagatcg<OLIGO_3_RV>ctgaacccaccgaaaagg</OLIGO_3_RV></AMPLICON_3>acaaggcctccggtgatttcgtctgggatgaagacgagtcggaggccctg<AMPLICON_4><OLIGO_4_FW>cgtc
aagcacgcaaggac</OLIGO_4_FW>gccgaactcaccgcatccgccgactcggttcgcgcctacctcaaacagatcggcaaggtagcgctg
ctcaacgccgaggaagaggtcgagc<OLIGO_4_RV>tagccaagcggatcgagg</OLIGO_4_RV></AMPLICON_4>ctggcctgtacgccacgcagctgatgaccgagcttag
cgagcgcggcgaaaagctgcctgccgcccagcgccgcgacatgatgtggatctgccgcgacggcgatcg<AMPLICON_5><OLIGO_5_FW>cgcgaaaaacc
atctgct</OLIGO_5_FW>ggaagccaacctgcgcctggtggtttcgctagccaagcgctacaccggccggggcatggcgtttctcgacc<OLIGO_5_RV>tg
atccaggaaggcaacc</OLIGO_5_RV></AMPLICON_5>tggggctgatccgcgcggtggagaagttcgactacaccaaggggtacaagttctccaccta<AMPLICON_6><OLIGO_6_FW>cgc
tacgtggtggattcg</OLIGO_6_FW>ccaggccatcacccgcgccatggccgaccaggcccgcaccatccgcatcccggtgcacatggtcg
aggtgatcaacaagctgggccgc<OLIGO_6_RV>attcaacgcgagctgctg</OLIGO_6_RV></AMPLICON_6>caggacctgggccgcgagcccacgcccgaggagctggcc
aaagagatggacatcaccccggagaaggtgctggaaatccagcaatacgcccgcgag<AMPLICON_7><OLIGO_7_FW>ccgatctcgttggaccag</OLIGO_7_FW>accat
cggcgacgagggcgacagccagcttggcgatttcatcgaagacagcgaggcggtggtggccgtcgacgcggtgt<OLIGO_7_RV>ccttca
ctttgctgcagg</OLIGO_7_RV></AMPLICON_7>atcaactgcagtcggtgctggacacgctctccgagcgtgaggcgggcgtggtgcggctacgcttcggc
cttaccgacggccagccgcgcacccttgacgagatcggccaggtctacggcgtgacccgggaacgcatccgccagatcga
atccaagactatgtcgaagttgcgccatccgagccgctcacaggtcctgcgcgactacctggactga</SEQUENCE_No_name>

Data retention

We garantee that your results will remain on the server for at least 14 days. However, if you know you won't access this result anymore, you may choose to delete it from the server immediately.

NOTE: This file is part of the PCRTiler tutorial. It cannot be deleted.